Difference between revisions of "Wrapping"

From Wiki
Jump to navigation Jump to search
m
(minor changes)
Line 1: Line 1:
Very long continuous strings (such as SHA512 keys or DNA sequences) might have to be broken after any character irrespective of the current hyphenation scheme.
+
Very long continuous strings (such as SHA512 keys or DNA sequences) might have to be broken after any character, independent from the current hyphenation scheme.
  
 
== Example SHA512 ==
 
== Example SHA512 ==
This is Hans' trick from the list for SHA512 keys
+
This is Hans’ trick from the list for SHA512 keys
  
<texcode>
+
<context source="yes">
 
\startluacode
 
\startluacode
  
Line 93: Line 93:
 
\showframe
 
\showframe
  
\starttext
+
\startTEXpage[offset=3em]
  
 
\setupalign[tolerant,stretch]
 
\setupalign[tolerant,stretch]
Line 104: Line 104:
 
}
 
}
  
\stoptext
+
\stopTEXpage
 
</texcode>
 
</texcode>
  

Revision as of 09:35, 4 February 2023

Very long continuous strings (such as SHA512 keys or DNA sequences) might have to be broken after any character, independent from the current hyphenation scheme.

Example SHA512

This is Hans’ trick from the list for SHA512 keys

\startluacode

     -- local shared = {
     --     start  = 1,
     --     length = 1,
     --     left   = false,
     --     right  = false,
     -- }

     local shared = {
         start  = 1,
         length = 1,
         before = utf.char(0xB7),
         after  = nil,
         left   = false,
         right  = false,
     }

     -- languages.hyphenators.traditional.installmethod("sha",
     --     function(dictionary,word,n)
     --         local t = { }
     --         for i=1,#word do
     --             t[i] = shared
     --         end
     --         return t
     --     end
     -- )

     -- or more efficient when used often:

     -- local all = { }
     -- for i=1,512 do
     --     all[i] = shared
     -- end
     -- languages.hyphenators.traditional.installmethod("sha",
     --     function(dictionary,word,n)
     --         return all
     --     end
     -- )

     -- or more obscure:

     -- local all = table.setmetatableindex({ }, function(t,k)
     --     t[k] = shared
     --     return shared
     -- end)
     --
     -- languages.hyphenators.traditional.installmethod("sha",
     --     function(dictionary,word,n)
     --         return all
     --     end
     -- )

     -- or just (lua is fast enough anyway)

     local all = table.setmetatableindex({ }, function(t,k)
         return shared
     end)

     languages.hyphenators.traditional.installmethod("sha",
         function(dictionary,word,n)
             return all
         end
     )
\stopluacode

\definehyphenationfeatures
   [sha]
   [characters=all,
    alternative=sha]

% \unexpanded\def\sha#1%
%   {\begingroup
%    \sethyphenationfeatures[sha]%
%    #1%
%    \endgroup}
%
% \setuphyphenation[method=traditional]

\unexpanded\def\sha#1%
   {\begingroup
    \sethyphenationfeatures[sha]%
    \setuphyphenation[method=traditional]%
    #1%
    \endgroup}

\showframe

\startTEXpage[offset=3em]

\setupalign[tolerant,stretch]

\dorecurse {10} {%
     some sha
     \sha{8b2f3c087046c3943ace0dc4f958ef2138e58a51b40e%
ef6fab6fa1aeb845cc257a410ab1b914bc399b4293f%
31c76fc2c73e5be5ea4d329f9e6820984688efec2} and
}

\stopTEXpage


== Example DNA sequences ==

This is an adoption from Wolfang using Lua:
="yes">
\startluacode

    local shared = {
        start  = 1,
        length = 1,
        before = nil,
        after  = nil,
        left   = false,
        right  = false,
    }

    local all = table.setmetatableindex({ }, function(t,k)
        return shared
    end)

    languages.hyphenators.traditional.installmethod("dna",
        function(dictionary,word,n)
            return all
        end
    )
\stopluacode

\definehyphenationfeatures
 [dna]
 [characters=all,
  alternative=dna]

\startframedtext[width=6cm,style=mono]
 \sethyphenationfeatures[dna]
 \setuphyphenation[method=traditional]
 GATTGCTTACTCCTGGTTGGTGGGGCTTACATTCTGTCGCCTCAAAACTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGG
\stopframedtext

And a solution using \handletokens by Rik:

\define[1]\DNA{\handletokens #1\with\DNAspacer}
\define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt}


\startframedtext[width=6cm,style=mono]
\DNA{GATTGCTTACTCCTGGTTGGTGGGGCTTACATTCTGTCGCCTCAAAACTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGG}
\stopframedtext

One caveat, however: this method always adds the spacer value, and can result in a blank line at the end in some cases, even when the spacer value is zero. This is not the case with the lua mechanism.

See also

Verbatim with line breaks for another solution to the problem above.

Help from ConTeXt-Mailinglist/Forum

All issues with: