Difference between revisions of "Wrapping"

From Wiki
Jump to navigation Jump to search
(interleaving colons as a workaround)
 
(One intermediate revision by one other user not shown)
Line 125: Line 125:
 
=== Another workaround interleaving colons ===
 
=== Another workaround interleaving colons ===
  
−
Another workaround that also helps to improve readability are interleaved colons every two characters. Of course you might change the number of chars without colons adding single dots to <code>str:match("..")</code>. Please, keep in mind that this will make line wrapping not easier in some places.  
+
Another workaround that also helps to improve readability are interleaved colons every two characters. Of course you might change the number of chars without colons adding single dots to <code>str:match("..")</code>. Please, keep in mind that this will make line wrapping not easier in some places. Of course, there is also a way to shorten the hash string.<ref>A richer sample could set a smaller string length, another interval and a different character.
 +
 
 +
<context source="yes">
 +
\startluacode
 +
require("util-sha")
 +
function document.coloniter(str,long,inter,sep)
 +
  local n = 0
 +
 
 +
  long = tonumber(long)
 +
  inter = tonumber(inter)
 +
 
 +
  if inter == "" then inter = 2 end
 +
  if sep == "" then sep = ":" end
 +
 
 +
  if long ~= nil and long > 0 then
 +
    if long % inter > 0 then
 +
      long = long + (inter - (long % inter))
 +
    end
 +
    str = str:sub(0,long)
 +
  end
 +
 
 +
  for c in str:gmatch(("."):rep(inter)) do
 +
    if n > 0 then
 +
      context(("%s%s"):format(sep,c))
 +
    else
 +
      context(c)
 +
    end
 +
    n = n + 1
 +
  end
 +
end
 +
\stopluacode
 +
 
 +
\unexpanded\def\hsa[#1][#2][#3][#4]%
 +
  {{\tt\hyphenatedurl
 +
    {\ctxlua{document.coloniter(utilities.sha2.hash512("#1"),"#2","#3","#4")}}}}
 +
 
 +
\unexpanded\def\hsafile[#1][#2][#3][#4]%
 +
  {\doiffileelse{#1}{{\tt\hyphenatedurl
 +
    {\ctxlua{document.coloniter(utilities.sha2.hash512(io.loaddata("#1")),"#2","#3","#4")}}}}
 +
    {{\bfd\color[red]{\type{#1} not available!!!}}}}
 +
 
 +
\setupbodyfont[24pt]
 +
 
 +
\starttext
 +
\startTEXpage[offset=1dk]
 +
This is a sequence: \hsa[This is a sequence][10][3][].
 +
 
 +
This is a file: \hsafile[\jobname.tex][23][5][-].
 +
\stopTEXpage
 +
\stoptext
 +
</context>
 +
 
 +
In this sample, the four arguments are the string (or the file) to be hashed, the length of the hash string, how many characters each interval has, and the interleaved character. Consider that not all chars break lines with {{cmd|hyphenatedurl}} -
 +
</ref>
  
 
<context source="yes">
 
<context source="yes">
Line 152: Line 205:
 
     {{\bfd\color[red]{\type{#1} not available!!!}}}}
 
     {{\bfd\color[red]{\type{#1} not available!!!}}}}
  
−
\starttext
+
\setupbodyfont[24pt]
 +
 
 
\startTEXpage[offset=1dk]
 
\startTEXpage[offset=1dk]
 
This is a sequence: \hsa[This is a sequence].
 
This is a sequence: \hsa[This is a sequence].
Line 162: Line 216:
 
== Example DNA sequences ==
 
== Example DNA sequences ==
  
−
This is an adoption from Wolfang using Lua:
+
This is an adoption from Wolfgang using Lua:
 
<context source="yes">
 
<context source="yes">
 
\startluacode
 
\startluacode

Latest revision as of 23:28, 5 October 2023

Very long continuous strings (such as SHA512 keys or DNA sequences) might have to be broken after any character, independent from the current hyphenation scheme.

Line breaking with SHA512 sums

Hans provided a way of breaking SHA512 sums in lines (now being checked).[1]

Workaround with soft hyphens

As a workaround, a simpler way to break SHA sums in lines, but without any character would be (abusing both \handletokens and \softhyphen): 

\define[1]\SHA{{\tt\handletokens #1\with\SHABreak}}
\define[1]\SHABreak{#1\softhyphen\hskip 0pt}
\startTEXpage[offset=1em, width=15em]
SHA sum \SHA{8b2f3c087046c3943ace0dc4f958ef2138e58a51b40e%
ef6fab6fa1aeb845cc257a410ab1b914bc399b4293f%
31c76fc2c73e5be5ea4d329f9e6820984688efec2}
\stopTEXpage

Another workaround interleaving colons

Another workaround that also helps to improve readability are interleaved colons every two characters. Of course you might change the number of chars without colons adding single dots to str:match(".."). Please, keep in mind that this will make line wrapping not easier in some places. Of course, there is also a way to shorten the hash string.[2] 

\startluacode
require("util-sha")
function document.coloniter(str)
  local n = 0
  for c in str:gmatch("..") do
    if n > 0 then
      context((":%s"):format(c))
    else
      context(c)
    end
    n = n + 1
  end
end
\stopluacode

\unexpanded\def\hsa[#1]%
  {{\tt\hyphenatedurl%
    {\ctxlua{document.coloniter(utilities.sha2.hash512("#1"))}}}}

\unexpanded\def\hsafile[#1]%
  {\doiffileelse{#1}{{\tt\hyphenatedurl
    {\ctxlua{document.coloniter(utilities.sha2.hash512(io.loaddata("#1")))}}}}
    {{\bfd\color[red]{\type{#1} not available!!!}}}}

\setupbodyfont[24pt]

\startTEXpage[offset=1dk]
This is a sequence: \hsa[This is a sequence].
\blank
This is a file: \hsafile[\jobname.tex]
\stopTEXpage

Example DNA sequences

This is an adoption from Wolfgang using Lua: 

\startluacode

    local shared = {
        start  = 1,
        length = 1,
        before = nil,
        after  = nil,
        left   = false,
        right  = false,
    }

    local all = table.setmetatableindex({ }, function(t,k)
        return shared
    end)

    languages.hyphenators.traditional.installmethod("dna",
        function(dictionary,word,n)
            return all
        end
    )
\stopluacode

\definehyphenationfeatures
 [dna]
 [characters=all,
  alternative=dna]

\startframedtext[width=6cm,style=mono]
 \sethyphenationfeatures[dna]
 \setuphyphenation[method=traditional]
 GATTGCTTACTCCTGGTTGGTGGGGCTTACATTCTGTCGCCTCAAAACTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGG
\stopframedtext

And a solution using \handletokens by Rik: 

\define[1]\DNA{\handletokens #1\with\DNAspacer}
\define[1]\DNAspacer{#1­\hskip 2.3pt plus .1pt}


\startframedtext[width=6cm,style=mono]
\DNA{GATTGCTTACTCCTGGTTGGTGGGGCTTACATTCTGTCGCCTCAAAACTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGG}
\stopframedtext

One caveat, however: this method always adds the spacer value, and can result in a blank line at the end in some cases, even when the spacer value is zero. This is not the case with the lua mechanism.

See also

Verbatim with line breaks for another solution to the problem above.

Help from ConTeXt-Mailinglist/Forum

All issues with:

Footnotes

  1. ↑ There might be an issue with the custom hyphenator that needs to be reviewed, since the first characters in the new line are missing. 
    \startluacode

     -- local shared = {
     --     start  = 1,
     --     length = 1,
     --     left   = false,
     --     right  = false,
     -- }

     local shared = {
         start  = 1,
         length = 1,
         before = utf.char(0xB7),
         after  = nil,
         left   = false,
         right  = false,
     }

     -- languages.hyphenators.traditional.installmethod("sha",
     --     function(dictionary,word,n)
     --         local t = { }
     --         for i=1,#word do
     --             t[i] = shared
     --         end
     --         return t
     --     end
     -- )

     -- or more efficient when used often:

     -- local all = { }
     -- for i=1,512 do
     --     all[i] = shared
     -- end
     -- languages.hyphenators.traditional.installmethod("sha",
     --     function(dictionary,word,n)
     --         return all
     --     end
     -- )

     -- or more obscure:

     -- local all = table.setmetatableindex({ }, function(t,k)
     --     t[k] = shared
     --     return shared
     -- end)
     --
     -- languages.hyphenators.traditional.installmethod("sha",
     --     function(dictionary,word,n)
     --         return all
     --     end
     -- )

     -- or just (lua is fast enough anyway)

     local all = table.setmetatableindex({ }, function(t,k)
         return shared
     end)

     languages.hyphenators.traditional.installmethod("sha",
         function(dictionary,word,n)
             return all
         end
     )
\stopluacode

\definehyphenationfeatures
   [sha]
   [characters=all,
    alternative=sha]

% \unexpanded\def\sha#1%
%   {\begingroup
%    \sethyphenationfeatures[sha]%
%    #1%
%    \endgroup}
%
% \setuphyphenation[method=traditional]

\unexpanded\def\sha#1%
   {\begingroup
    \sethyphenationfeatures[sha]%
    \setuphyphenation[method=traditional]%
    #1%
    \endgroup}

\showframe

\startTEXpage[offset=3em]

\setupalign[tolerant,stretch]

\dorecurse {10} {%
     some sha
     \sha{8b2f3c087046c3943ace0dc4f958ef2138e58a51b40e%
ef6fab6fa1aeb845cc257a410ab1b914bc399b4293f%
31c76fc2c73e5be5ea4d329f9e6820984688efec2} and
}

\stopTEXpage
  2. ↑ A richer sample could set a smaller string length, another interval and a different character. 
    \startluacode
require("util-sha")
function document.coloniter(str,long,inter,sep)
  local n = 0

  long = tonumber(long)
  inter = tonumber(inter)

  if inter == "" then inter = 2 end
  if sep == "" then sep = ":" end

  if long ~= nil and long > 0 then
    if long % inter > 0 then
      long = long + (inter - (long % inter))
    end
    str = str:sub(0,long)
  end

  for c in str:gmatch(("."):rep(inter)) do
    if n > 0 then
      context(("%s%s"):format(sep,c))
    else
      context(c)
    end
    n = n + 1
  end
end
\stopluacode

\unexpanded\def\hsa[#1][#2][#3][#4]%
  {{\tt\hyphenatedurl
    {\ctxlua{document.coloniter(utilities.sha2.hash512("#1"),"#2","#3","#4")}}}}

\unexpanded\def\hsafile[#1][#2][#3][#4]%
  {\doiffileelse{#1}{{\tt\hyphenatedurl
    {\ctxlua{document.coloniter(utilities.sha2.hash512(io.loaddata("#1")),"#2","#3","#4")}}}}
    {{\bfd\color[red]{\type{#1} not available!!!}}}}

\setupbodyfont[24pt]

\starttext
\startTEXpage[offset=1dk]
This is a sequence: \hsa[This is a sequence][10][3][].

This is a file: \hsafile[\jobname.tex][23][5][-].
\stopTEXpage
\stoptext

    In this sample, the four arguments are the string (or the file) to be hashed, the length of the hash string, how many characters each interval has, and the interleaved character. Consider that not all chars break lines with \hyphenatedurl -

Retrieved from "https://wiki.contextgarden.net/index.php?title=Wrapping&oldid=34239"